Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circ_0067934 | |||
Gene | PRKCI | Organism | Human |
Genome Locus | chr3:170013698-170015181:+ | Build | hg19 |
Disease | Thyroid Carcinoma | ICD-10 | Malignant neoplasm of skin, unspecified (C44.9) |
DBLink | Link to database | PMID | 30779728 |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | A total of 57 thyroid cancer tissue samples and paracancer tissue samples were collected |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TAGCAGTTCCCCAATCCTTG ReverseCACAAATTCCCATCATTCCC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Wang, H, Yan, X, Zhang, H, Zhan, X (2019). CircRNA circ_0067934 Overexpression Correlates with Poor Prognosis and Promotes Thyroid Carcinoma Progression. Med. Sci. Monit., 25:1342-1349. |